cDNA/AFLP
A tool for transcriptome analysis
for a
PDF version of
this protocol click
here
April 2004
CWB BACHEM
1. RNA Isolation
1.1. Plant tissue material is harvested and immediately frozen in liquid N2. The material is then ground to a fine powder in a pre-cooled pestle and mortar under liquid N2. (This material can be stored at -80°C indefinitely). To proceed with extraction, transfer around 1g of powdered material into pre-cooled 50 ml plastic tubes (usually around 5 ml volume).
1.2. Transfer 10 ml of a hot (80°C) 1:1 mixture of RNA extraction buffer and phenol (base volume: 5 ml) into the tube containing plant material. Be sure that no liquid N2 remains in the sample when adding the extraction buffer. Vortex or manually shake the samples vigorously for at least 30 seconds.
1.3. To the mixture add a base volume of chloroform (5 ml) and shake vigorously. To separate the phases, centrifuge the samples for 20 minutes (3500 rpm in a large swing-out rotor). Repeat chloroform extraction with one base volume (5ml) until no inter-phase can be detected (at least twice).
1.4. Transfer resultant cleared aqueous phase to a new 50 ml tube (ca. 5.5 ml; this material can be stored frozen for 24 h). Add 1/3 volume of ice cold 8M LiCl and precipitate for at least 3 h at 0°C (or over night). Centrifuge RNA at 0°C for 20 minutes (3500 rpm) and resuspend in 500 µl H2O after extensive washing of the pellet with 75% Ethanol (ice cold). Take a small aliquot of this sample or determine concentration, integrity and purity of the RNA (1µl for agarose gel and 1µl for spectrophotometer).
1.5. Precipitate RNA in 2 volumes 96% Ethanol in the presence of 1/10 volume 3 M Na Acetate pH 5.3 for 1h and centrifuge. Resuspend the RNA pellet thoroughly in H2O (heat for 5 minutes at 65°C to help resuspension if necessary) to obtain a 1 µg/µl RNA solution.
2. Bead preparation (poly d[T]25V beads) (Dynabeads M-280 streptavidin, Dynal Biotech)
2.1. Use 0.5 mg (50 µl) of bead suspension per 50 µg total-RNA. Wash the beads twice in an equal volume of STEX buffer. Resuspend the beads in 2 vol. of 2x-STEX buffer (100 µl).
2.2. Add 2 vol (100 µl) of biotinylated d[T]25V oligonucleotide (Oligo00) [10ng/µl] (20 ng oligo00/µl beads). 1 mg of streptavidine beads binds 200 pM of biotinylated d[T]25V oligonucleotide (Oligo00) thus, 2000 ng of Oligo00 gives 1.5 excess. Incubate at room temperature for 30’.
2.3. Wash the beads three times with 2 vol of STEX buffer (100 µl) to eliminate unbound Oligo0. After the last wash, resuspend beads in 1 vol (50 µl) of 2x-STEX buffer.
3. [1]Poly-A+ RNA enrichment and cDNA synthesis
3.3. Take 50 µg of total RNA [1 µg/µl] and add to the 50 µl beads prepared previously. Incubate at room temperature for 10’and subsequently on ice for 5’.
3.4. Wash bead / RNA mixture 3 times in STEX buffer (100 µl). Eliminate all traces of STEX buffer by centrifugation after the last wash. Finally, resuspend the beads in 20 µl of H2O.
3.5. Incubate beads at 65°C for 5 min and immediately place in MPC and transfer the 20µl poly-A+ solution into a new tube. (Usually < 20 µl). (Alternatively, two elutions with 10 µl H2O at 65ºC can be done instead).
3.6. Prepare the following first strand cDNA synthesis reaction mix:
20.00 µl Poly A+ RNA
1.00 µl primer d[T]25V (from 100 ng/µl stock)
6.00 µl 5 x cDNAI buffer (Superscript II buffer)
1.00 µl dNTPs (25 mM)
1.00 µl Reverse transcriptase (200 U, Invitrogen SuperScript II)
2.00 µl DTT (100 mM)
----------
31.00 µl Incubate for 1 h at 42°C
3.7. To the first strand mix add the following:
15.00 µl 10 x cDNAII buffer
3.50 µl DNA Polymerase I (10U/µl) (Invitrogen)
1.50 µl RNase H (2U/µl) (Invitrogen)
1.00 µl dNTPs (25 mM)
98.00 µl H2O
----------
150.00 µl Incubate for 2 h at 16°C.
3.8. Use a 5µl aliquot of this sample and check on an agarose gel: a clear DNA-smear between 500-4000 bp should be visible (see figure). Phenol-Chloroform extract the rest of the cDNA sample (145µl) and precipitate with 0.6 vol. isopropanol.
3.9. Resuspend the cDNA in 40µl H2O. Half this amount can then be used for template preparation and half stored for future use.
Single and double stranded cDNA;
4. Template preparation
4.3. Mix the following restriction digests:
20.00 µl cDNA
1.00 µl Enzyme (1) – TaqI (10U)
8.00 µl R/L buffer (5 x)
11.00 µl H2O
----------
40.00 µl
Incubate at the temperature appropriate for the Enzyme (1) for 1 h. (65°C).
4.4. To the first digest mix add the following:
1.00 µl R/L buffer (5 x)
2.00 µl Enzyme (2) - AseI (10U)
7.00 µl H2O (add 10 µl / tube)
----------
50.00 µl Incubate at 37°C for 1 h.
4.5. Anchor (adapter) preparation: Take 25 µg of the top strand oligo (61) and 22 µg of the bottom strand oligo (62) (1 µg/µl stocks) and increase volume to 100 µl H2O. This gives a 50 pM stock of TaqI anchor.
Oligo61(T-top)/Oligo62 (T-bottom) 5’-GACGATGAGTCCTGAC
TACTCAGGACTGGC- 5’
Take 2.6 µg of the top strand oligo (41) and 2.0 µg of the bottom strand oligo (42) (1µg/µl stocks) and increase volume to 100 µl H2O. This gives a 5 pM stock of AseI anchor.
Oligo41(A-top)/Oligo42 (A-bottom) 5’-CTCGTAGACTGCGTACC
CTGACGCATGGAT- 5’
4.6. For the ligation of the anchors add the following:
1.00 µl anchor (1) (50 pM: TaqI)
1.00 µl anchor (2) (5 pM: AseI)
1.00 µl 10 mM ATP
0.50 µl 1,4 All buffer (10 x)
1.00 µl T4 DNA ligase (1U/µl)
0.50 µl H2O (add 5 µl / tube)
--------
55.00 µl Incubate for 2 h at 37°C.
The ligation product is termed primary template and is used directly for pre-amplification.
5. Pre-amplification of the template
10.00 µl 10 x dilution Primary template
1.00 µl Primer 1 (oligo43/A00, 100 ng/µl stock)
1.00 µl Primer 2 (oligo63/T00, 100 ng/µl stock)
5.00 µl PCR buffer (10x Superbuffer, SphaeroQ)
0.50 µl dNTPs (25 mM)
0.25 µl Taq-Pol (SuperTaq 5U/µl)
32.25 µl
----------
50.00 µl
Cycle: [94°C, 30 sec; 55°C, 30 sec; 72°C, 60 sec] x 25 cycles
Check the products on an agarose gel and estimate the concentration. The material should appear as a smear between 50-700 bp (see Panel II below). There should be no visible smearing above 2 kb and no residue around the well (as in Panel I below). At this stage, products of abundant transcripts may be visible as prominent bands in the smear.
Dilute the material to a concentration
of about 1ng/µl (usually 20 - 50 x dilution). This material (secondary template)
is used as a template in the active PCR using the AFLP protocol (see Gel Sheet
below).
Notes:
- Quality control for first-time users:
1) Check the total RNA for integrity and concentration (all samples). rRNAs should be clear and no degradation products visible.
2) Check presence of poly A+ RNA on gel controlling size distribution and enrichment level (some rRNA always remains).
3) Double stranded cDNA should show a size distribution between about 0.5 - 5KB with the bulk of the smear around 1.5 KB. Some tissues produce prominent transcripts that appear as bands in the cDNA.
4) Complete restriction enzyme digestion can be monitored using control DNA.
5) Ligation of anchors (adaptors) can be best monitored by PCR of the primary template (ligation mix) and should yield a strong smear between 600 bp - 50 bp.
- Apart from the total-RNA that should also be checked photospectrometrically, the assessment of the material can be done on agarose gel electrophoresis. Although these checks are a good idea in the beginning later, only an analysis of the "pre-amp" is necessary (the amplification of the primary template with primers lacking selective extensions).
- Another restriction enzyme pair (REP) commonly used with good results is EcoRI/MseI. Data from our lab and others indicates that a wide range of REPs yield similar fingerprints in terms of quality and fragment numbers.
- To obtain just one TDF per transcript a restriction enzyme with a 5-bp recognition sequence can be used. The protocol involves cutting with the 5-bp cutter and then capturing the 3’-ends of the cDNAs on magnetic beads. After elimination of the free 5’-fragments TDFs can be released from the beads with the frequent cutter. This method can also achieve a higher transcript visualisation level.
- Protocols for verification of band identity are available (see Ron van der Hulst or Bart Brugmans) and should be used where TDFs are to be isolated from gels.
- Very small quantities of RNA can be successfully used as a starting point for cDNA-AFLP. The amounts mentioned in the protocol should however be proportionally scaled down. Scaling down the procedure also allows the use of micro-titre pate (96 well) format making high throughput applications possible.
- All glassware, disposables and solutions that come into contact with RNA should be RNase free. Autoclaving usually gives enough protection and DEPC treatment or use of RNase inhibitors is unnecessary.
6. Buffers:
– 2 x STEX (autoclave) 2.0 M NaCl
20.0 mM Tris-HCl
2.0 mM EDTA
0.2 % Triton X-100 pH 8.0
– RNA extraction buffer (autoclave) 100.0 mM Tris-HCl
100.0 mM LiCl
10.0 mM EDTA
1.0 % SDS pH 8.0
– 10 x cDNAII buffer (use sterile components; filter sterilise) 200.0 mM Tris-HCl
750.0 mM KCl
100.0 mM (NH4)2SO4
50.0 mM MgCl2
10.0 mM DTT pH 7.5
– R/L buffer (x5) (10x)-“One-For-All” buffer 500 µl
BSA purified (10mg/ml) 25 µl
DTT (1M) 25 µl
Milli-Q 450 µl
7. Selective amplification with IRD 700 / 800 labelled primers
IRD 700 IRD 800
20x / 50x dilution secondary template 5.00 µl 5.00 µl
Labelled-Primer 1 (AseI (+2), 1 pmol /µl stock) 0.5 µl 0.6 µl
Primer 2 (TaqI (+2), 50 ng/µl stock) 0.3 µl 0.3 µl
10x PCR buffer (Superbuffer, SphaeroQ) 1.0 µl 1.00 µl
dNTPs (5 mM) 0.40 µl 0.40 µl
Taq-Pol (SuperTaq 5U/µl; SphaeroQ) 0.04 µl 0.04 µl
H2O 2.80 µl 2.70 µl
---------- ----------
10.00 µl 10.00 µl
Touch-down profile:
(94ºC, 30 sec; 65 – 56ºC (decrease 0.7ºC each cycle), 30 sec; 72ºC, 60sec) x 12
Continue with :
(94ºC, 30 sec; 56ºC, 30 sec; 72ºC, 60 sec) x 24
8. Protocol for preparing LI-COR gels (follow manufacturer’s instructions)
8.1. 6% Long Ranger gel (7M Urea/1.2x TBE):
252 g Urea
72 ml Long Ranger 50% gel solution
72 ml 10x TBE
Add distilled water to a target weigh of 675 g
Use 20 ml/gel (248 x 254 mm plates, 0.25 mm spacers). Polymerise with 150 µl 10% APS and 15 µl TEMED.
8.2. To the selective amplification product add an equal vol (10µl) of formamide loading buffer (98% formamide, 10 mM EDTA pH8.0 and 0.1% Bromophenol blue). Vortex and centrifuge for 3 minutes at 1000 rpm. Denature the samples by heating 5 minutes at 94°C. The samples are placed on ice until loaded.
8.3. Pre-warm the gel to 45°C. Load 0.5-0.8 µl sample.
9. Preparation of the IRD 700 / 800 labelled SEQUAMARK™ 10 bp ladder
29 µl Milli Q
10 µl Circumvent polymerase buffer (10x, NEB)
48 µl dNTP/ddTTP mix (720µM ddTTP; 30µM dATP; 100µM dCTP; 100µM dGTP; 33µM dTTP)
5 µl Vent (exo-)DNA polymerase (NEB)
5 µl IRD700 or IRD800 primer (2 pmol/µl)
Subdivide in 4 PCR tubes
PCR: 94ºC, 5 min.; [94ºC, 30 sec; 56ºC, 30 sec; 72ºC, 30 sec] x 35 cycles; 72ºC, 7 min
10. Selective amplification with radioactively labelled primers
20x / 50x dilution secondary template 5.00 µl
Labelled-Primer 1 (AseI +2) * 0.25 µl
Primer 2 (TaqI (+2), 50 ng/µl stock) 0.3 µl
10x PCR buffer (Superbuffer, SphaeroQ) 1.0 µl
dNTPs (5 mM) 0.40 µl
Taq-Pol (SuperTaq 5U/µl)) 0.04 µl
H2O 3.01 µl
----------
10.00 µl
Touch-down profile:
(94ºC, 30 sec; 65 – 56ºC (decrease 0.7ºC each cycle), 30 sec; 72ºC, 60sec) x 12
Continue with :
(94ºC, 30 sec; 56ºC, 30 sec; 72ºC, 60 sec) x 24
* Labelling of the primer: 0.05 µl γ 33P label (10µCi/µl γ 33P-ATP)
0.05 µl primer (50 ng/µl)
0.01 µl T4 Kinase (10U/µl)
0.025 µl 10x T4 Kinase buffer
0.115 µl H2O
----------
0.25µl
Incubate for 60 min. at 37ºC. Terminate the reaction by heating at 70ºC for 10 min.
11. Protocol for preparing cDNA/AFLP polyacrylamide gels (BRL S2 system)
11.1. New glass plates are treated with 10 M NaOH to remove all dirt. The treatment is completed when the liquid stays as a film on the glass, and does no longer break into droplets. The short glass plate is siliconized or treated with Rain-X.
11.2. Clean both glass plates tap water, brush and soap. Rinse thoroughly and dry with tissue. Make sure that the water will stay as a film on long plate; the water should pearl on the short plate. When repeated cleaning with water and soap cannot achieve film or pearls respectively, then the NaOH or Rain-X treatment should be repeated. Clean with ethanol.
11.3. Put the spacers (thickness 0.4 mm) between the clean glass plates with the cushions against the edge of the shorter glass plate. Attach the clamps. Place the comb with the teeth upward and test it is neither tight nor loose.
11.4. Seal both sides with yellow tape (Scotch electrical tape). Press the tape firmly on the glass. Seal the bottom of the plates and make straight folds around the corners.
11.5. BRL S2 sequencing gels need approximately 80 ml of 5% polyacrilamide gel solution, to which 400 ml of 10% APS (w/v) and 80ml of TEMED is added. Store monthly fresh made APS and TEMED in refrigerator. Gel solution from the refrigerator will not polymerise as fast as gel solution at room temperature. Crystallisation of Urea will re-dissolve already after slightly increasing the temperature.
11.6. Pour the 5% acrylamide gel and place the comb (shark tooth) with the teeth upwards, to create a straight `running` front. The depth of the placement of the comb will determine the sample volume that can be loaded. It is recommended to align the edge of the holes in the comb with the edge of the glass (holes outside). Check the front, because irregularities will disturb the banding pattern. Put extra clamps to squeeze the comb between the glass, because the slightest amounts of acrylamide between glass and comb will remain as rubble in the wells. Allow the gel to polymerise for at least two hours. Wrap the gel with Saran against drying in case of o/n polymerisation.
11.7. Remove the comb and rinse the glass with tap water to remove with a soft brush all spilled acrylamide from of the glass and well. Mount the gel on the apparatus. Pre-run for approximately 1/2 hour with 1xTBE as running buffer. The 1x TBE buffer in the lower compartment is supplemented with 0.5 M NaAc, creating a salt gradient. This will slow down the small fragments in the lower part of the gel while improving the separation of the larger fragments in the upper part of the gel. This mimics a gradient gel electrophoresis.
11.8. After the pre-run rinse the well from acrylamide rubble and diffused Urea with a beam of liquid (buffer) using a syringe. Place the comb with the teeth downwards (just on top of the gel surface; teeth just for 0.5 mm in the gel).
11.9. To the 10 µl active PCR product add 20 µl formamide dye (98% formamide, 10 mM EDTA, 0.025% bromophenol blue and 0.025% xylene cyanol FF). Denature the samples with the formamide dye by heating them for 5 min. at 92ºC. Place samples on ice and load 2 to 5 µl. Leakage from the end wells can be prevented by loading a counterweight of loading buffer in the adjacent wells.
11.10. Electrophoresis is performed at constant power of 80 Watt per gel to give a constant heat development during running of the samples. The temperature should be 55ºC. After 2.5 hours of running (The Bromophenol Blue is compressing at the bottom or just running off. The Xylene Cyanol is at approx. 10 to 15 cm of the bottom) the run will be stopped and dismount the gel.
11.11. Remove the tape from both sides, and use a wedge to open the glass. The gel is covered by a Whatmann 3MM paper and attached to the paper it is removed from the glass. The other side of the gel is covered with Saran Wrap. Work fast because the Whatmann will swell from water, which will cause rims in the paper during drying on a standard slab dryer at 80 C for two hours. Use several sheets of filter paper to keep the gel dryer support plate free from activity.
11.12. Place the dry gels are placed on X-ray films (Kodak X-omat LS); make marks on the gel and film so that you will be able to align them afterwards, and developed after an appropriate exposure (1-3 days).
12. [2]Protocol for the isolation of amplified fragments from poly-acrylamide gels
12.1. Mark the film and the gel to orientate it while in the cassette. Develop the film normally.
12.2. Place the dried film onto the gel, lining up the orientation marks and identify the bands to be isolated (usually done best by placing film and gel on a light box and pencil marking band positions on the Whatman paper. Cut out the band and monitor the activity.
12.3. Incubate in 200 µl TE buffer for 2h at room temperature. Use 5 µl for direct PCR using same primers and conditions as in the pre-amplification.
Alternatively:
12.3. Cut out pieces of Whatman DE81 paper to the size of the gel fragments and insert both into incisions in a 2% agarose gel. Electro-elute at 100 V for 15 min.
12.4. Take out DE81 paper and remove excess TEA buffer on Whatman 3MM (do not dry out). Monitor activity on both gel fragment and DE81 paper - 90% of the activity should now be on the DEAE paper.
12.5. If necessary trim off excess paper and place in a 500 µl tube with a small hole punched in the base. Insert tube into a 1.5 ml eppendorf tube. Spin off remaining TEA buffer and wash twice with 100 µl LSB.
12.6. Elute DNA with 50 µl HSB at R/T for 15 min (for fragments larger that 500 bp, heat to 56°C for 10 min). Spin down supernatant into a new eppendorf tube. Check activity on the remaining paper. If activity is left on the paper, repeat elution.
12.7. Precipitate the DNA with 2.5 volumes of ethanol.
12.8. Using the same PCR conditions and primers re-amplify fragment for ca. 25 cycles - more cycles may be necessary for weak or small fragments.
12.9. The amplified fragment may be purified after separation on a 1.2% agarose gel or cloned directly.
LSB Buffer 10.0 mM TRIS pH 7.5
1.0 mM EDTA
100.0 mM LiCl
HSB Buffer 10.0 mM TRIS pH 7.5
1.0 mM EDTA
1.0 M LiCl
20.0 % Ethanol
13. AseI/TaqI PCR primers used for cDNA-AFLP
§ POLY D[T]25V, BIOTINYLATION AT 5' END
5’- TTTTTTTTTTTTTTTTTTTTTTTTV
Total number of bases is: 26.
DNA sequence composition: 0 A; 0 C; 0 G; 25 T; 1 OTHER;
Sequence name: OLIGO00
-----------------------------------------
§ TOP STRAND ADAPTOR - ASEI
5’- CTCGTAGACTGCGTACC
Total number of bases is: 17.
DNA sequence composition: 3 A; 6 C; 4 G; 4 T; 0 OTHER;
Sequence name: OLIGO41/ A-Top
-----------------------------------------
§ ADAPTOR BOTTOM STRAND - ASEI
5’- TAGGTACGCAGTC
Total number of bases is: 13.
DNA sequence composition: 3 A; 3 C; 4 G; 3 T; 0 OTHER;
Sequence name: OLIGO42 / A-bottom
-----------------------------------------
§ ASEI - + 0
5’- CTCGTAGACTGCGTACCTAAT
Total number of bases is: 21.
DNA sequence composition: 5 A; 6 C; 4 G; 6 T; 0 OTHER;
Sequence name: OLIGO43 / A00
-----------------------------------------
§ ASEI, + 2 – AA
5’- GACTGCGTACCTAATAA
Total number of bases is: 17.
DNA sequence composition: 6 A; 4 C; 3 G; 4 T; 0 OTHER;
Sequence name: OLIGO44 / A11
-----------------------------------------
§ ASEI, + 2, - AC
5’- GACTGCGTACCTAATAC
Total number of bases is: 17.
DNA sequence composition: 5 A; 5 C; 3 G; 4 T; 0 OTHER;
Sequence name: OLIGO45 / A12
-----------------------------------------
§ ASEI, + 2 - AG
5’- GACTGCGTACCTAATAG
Total number of bases is: 17.
DNA sequence composition: 5 A; 4 C; 4 G; 4 T; 0 OTHER;
Sequence name: OLIGO46 / A13
-----------------------------------------
§ ASEI, + 2 - AT
5’- GACTGCGTACCTAATAT
Total number of bases is: 17.
DNA sequence composition: 5 A; 4 C; 3 G; 5 T; 0 OTHER;
Sequence name: OLIGO47 / A14
-----------------------------------------
§ ASEI, + 2 - CA
5’- GACTGCGTACCTAATCA
Total number of bases is: 17.
DNA sequence composition: 5 A; 5 C; 3 G; 4 T; 0 OTHER;
Sequence name: OLIGO48 / A15
-----------------------------------------
§ ASEI, + 2 - CC
5’- GACTGCGTACCTAATCC
Total number of bases is: 17.
DNA sequence composition: 4 A; 6 C; 3 G; 4 T; 0 OTHER;
Sequence name: OLIGO49 /A16
-----------------------------------------
§ ASEI, + 2 - CG
5’- GACTGCGTACCTAATCG
Total number of bases is: 17.
DNA sequence composition: 4 A; 5 C; 4 G; 4 T; 0 OTHER;
Sequence name: OLIGO50 / A17
-----------------------------------------
§ ASEI, + 2 - CT
5’- GACTGCGTACCTAATCT
Total number of bases is: 17.
DNA sequence composition: 4 A; 5 C; 3 G; 5 T; 0 OTHER;
Sequence name: OLIGO51 / A18
-----------------------------------------
§ ASEI, + 2 - GA
5’- GACTGCGTACCTAATGA
Total number of bases is: 17.
DNA sequence composition: 5 A; 4 C; 4 G; 4 T; 0 OTHER;
Sequence name: OLIGO52 / A19
-----------------------------------------
§ ASEI, + 2 - GC
5’- GACTGCGTACCTAATGC
Total number of bases is: 17.
DNA sequence composition: 4 A; 5 C; 4 G; 4 T; 0 OTHER;
Sequence name: OLIGO53 / A20
-----------------------------------------
§ ASEI, + 2 – GG
5’- GACTGCGTACCTAATGG
Total number of bases is: 17.
DNA sequence composition: 4 A; 4 C; 5 G; 4 T; 0 OTHER;
Sequence name: OLIGO54 / A21
-----------------------------------------
§ ASEI, +2 - GT
5’- GACTGCGTACCTAATGT
Total number of bases is: 17.
DNA sequence composition: 4 A; 4 C; 4 G; 5 T; 0 OTHER;
Sequence name: OLIGO55 / A22
-----------------------------------------
§ ASEI, +2 - TA
5’- GACTGCGTACCTAATTA
Total number of bases is: 17.
DNA sequence composition: 5 A; 4 C; 3 G; 5 T; 0 OTHER;
Sequence name: OLIGO56 / A23
-----------------------------------------
§ ASEI, +2 - TC
5’- GACTGCGTACCTAATTC
Total number of bases is: 17.
DNA sequence composition: 4 A; 5 C; 3 G; 5 T; 0 OTHER;
Sequence name: OLIGO57 / A24
-----------------------------------------
§ ASEI, +2 - TG
5’- GACTGCGTACCTAATTG
Total number of bases is: 17.
DNA sequence composition: 4 A; 4 C; 4 G; 5 T; 0 OTHER;
Sequence name: OLIGO58 / A25
-----------------------------------------
§ ASEI, + 2 - TT
5’- GACTGCGTACCTAATTT
Total number of bases is: 17.
DNA sequence composition: 4 A; 4 C; 3 G; 6 T; 0 OTHER;
Sequence name: OLIGO59 / A26
-----------------------------------------
§ ADAPTOR, TOP STRAND-TAQI
5’- GACGATGAGTCCTGAC
Total number of bases is: 16.
DNA sequence composition: 4 A; 4 C; 5 G; 3 T; 0 OTHER;
Sequence name: OLIGO61 / T-Top
-----------------------------------------
§ ADAPTOR, BOTTOM STRANS - TAQI
5’- CGGTCAGGACTCAT
Total number of bases is: 14.
DNA sequence composition: 3 A; 4 C; 4 G; 3 T; 0 OTHER;
Sequence name: OLIGO62 / T-bottom
-----------------------------------------
§ TAQI, + 0
5’- GACGATGAGTCCTGACCGA
Total number of bases is: 19.
DNA sequence composition: 5 A; 5 C; 6 G; 3 T; 0 OTHER;
Sequence name: OLIGO63 / T00
-----------------------------------------
§ TAQI, + 2 - AA
5’- GATGAGTCCTGACCGAAA
Total number of bases is: 18.
DNA sequence composition: 6 A; 4 C; 5 G; 3 T; 0 OTHER;
Sequence name: OLIGO64 / T11
-----------------------------------------
§ TAQI, + 2 - AC
5’- GATGAGTCCTGACCGAAC
Total number of bases is: 18.
DNA sequence composition: 5 A; 5 C; 5 G; 3 T; 0 OTHER;
Sequence name: OLIGO65 / T12
-----------------------------------------
§ TAQI, + 2 - AG
5’- GATGAGTCCTGACCGAAG
Total number of bases is: 18.
DNA sequence composition: 5 A; 4 C; 6 G; 3 T; 0 OTHER;
Sequence name: OLIGO66 / T13
-----------------------------------------
§ TAQI, +2 - AT
5’- GATGAGTCCTGACCGAAT
Total number of bases is: 18.
DNA sequence composition: 5 A; 4 C; 5 G; 4 T; 0 OTHER;
Sequence name: OLIGO67 / T14
-----------------------------------------
§ TAQI, +2 - CA
5’- GATGAGTCCTGACCGACA
Total number of bases is: 18.
DNA sequence composition: 5 A; 5 C; 5 G; 3 T; 0 OTHER;
Sequence name: OLIGO68 / T15
-----------------------------------------
§ TAQI, +2 - CC
5’- GATGAGTCCTGACCGACC
Total number of bases is: 18.
DNA sequence composition: 4 A; 6 C; 5 G; 3 T; 0 OTHER;
Sequence name: OLIGO69 / T16
-----------------------------------------
§ TAQI, +2 - CG
5’- GATGAGTCCTGACCGACG
Total number of bases is: 18.
DNA sequence composition: 4 A; 5 C; 6 G; 3 T; 0 OTHER;
Sequence name: OLIGO70 / T17
-----------------------------------------
§ TAQI, +2 - CT
5’- GATGAGTCCTGACCGACT
Total number of bases is: 18.
DNA sequence composition: 4 A; 5 C; 5 G; 4 T; 0 OTHER;
Sequence name: OLIGO71 / T18
-----------------------------------------
§ TAQI, +2 - GA
5’- GATGAGTCCTGACCGAGA
Total number of bases is: 18.
DNA sequence composition: 5 A; 4 C; 6 G; 3 T; 0 OTHER;
Sequence name: OLIGO72 / T19
-----------------------------------------
§ TAQI, +2 - GC
5’- GATGAGTCCTGACCGAGC
Total number of bases is: 18.
DNA sequence composition: 4 A; 5 C; 6 G; 3 T; 0 OTHER;
Sequence name: OLIGO73 / T20
-----------------------------------------
§ TAQI, +2 - GG
5’- GATGAGTCCTGACCGAGG
Total number of bases is: 18.
DNA sequence composition: 4 A; 4 C; 7 G; 3 T; 0 OTHER;
Sequence name: OLIGO74 / T21
-----------------------------------------
§ TAQI, +2 - GT
5’- GATGAGTCCTGACCGAGT
Total number of bases is: 18.
DNA sequence composition: 4 A; 4 C; 6 G; 4 T; 0 OTHER;
Sequence name: OLIGO75/ T22
-----------------------------------------
§ TAQI, +2 - TA
5’- GATGAGTCCTGACCGATA
Total number of bases is: 18.
DNA sequence composition: 5 A; 4 C; 5 G; 4 T; 0 OTHER;
Sequence name: OLIGO76 / T23
-----------------------------------------
§ TAQI, +2 - TC
5’- GATGAGTCCTGACCGATC
Total number of bases is: 18.
DNA sequence composition: 4 A; 5 C; 5 G; 4 T; 0 OTHER;
Sequence name: OLIGO77 / T24
-----------------------------------------
§ TAQI, +2 - TG
5’- GATGAGTCCTGACCGATG
Total number of bases is: 18.
DNA sequence composition: 4 A; 4 C; 6 G; 4 T; 0 OTHER;
Sequence name: OLIGO78 / T25
-----------------------------------------
§ TAQI, +2 - TT
5’- GATGAGTCCTGACCGATT
Total number of bases is: 18.
DNA sequence composition: 4 A; 4 C; 5 G; 5 T; 0 OTHER;
Sequence name: OLIGO79 / T26
Further reading:
1. Bachem, C. W. B., Oomen, R. J. F. J.and Visser, R. G. F. Transcript imaging with cDNA-AFLP: A step-by-step protocol. Plant Mol. Biol. Rep. 1998; 16:157-173.
2. Bachem, C. W. B., van der Hoeven, R. S., de Bruijn, S. M., Vreugdenhil, D., Zabeau, M.and Visser, R. Visualisation of differential gene expression using a novel method of RNA finger-printing based on AFLP: Analysis of gene expression during potato tuber development. Plant J. 1996; 9:745-753.
3. Bachem, C. W. B., van der Hoeven, R. S., Lucker, J., Oomen, R. J. F. J., Casarini, E., Jacobsen, E.and Visser, R. G. F. Functional genomic analysis of potato tuber life-cycle. Potato Res. 2000; 43:297-312.
[1] Poly-A+ RNA isolation is not required for the procedure, especially when isolating RNA from small amounts of tissue. However, when total RNA is used for template preparation, DNaseI treatment is required.
[2] Since fragment isolation from PAGE can give rise to various artefacts, it is important to verify band identity using the appropriate protocols.
